Sequence retrieval

Genome: Mycobacterium abscessus subsp. bolletii 50594
Start position: 150041
End position: 150076
Length: 36

DNA sequence
>NC_021282, from 150041 to 150076 (36 bp); Mycobacterium abscessus subsp. bolletii 50594 GTCGGCTGCTGGGTCGTCTGCTGCGTTGGTTGCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 149831-151579	Sequence	MASS_0149 - hypothetical protein (Protein is coded in complementary strand; from 151579 to 149831)