Sequence retrieval

Genome: Mycobacterium abscessus subsp. bolletii 50594
Start position: 1697585
End position: 1697608
Length: 24

DNA sequence
>NC_021282, from 1697585 to 1697608 (24 bp); Mycobacterium abscessus subsp. bolletii 50594 GCGCCGGTTCGCCGGTGCGCCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1697542-1698339	Sequence	MASS_1671 - formamidopyrimidine-DNA glycolase