Sequence retrieval

Genome: Mycobacterium abscessus subsp. bolletii 50594
Start position: 1960777
End position: 1960800
Length: 24

DNA sequence
>NC_021282, from 1960777 to 1960800 (24 bp); Mycobacterium abscessus subsp. bolletii 50594 CAGGAGCAGGAGCAGGAGCAGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1959690-1961453	Sequence	MASS_1933 - dihydrolipoamide acetyltransferase (Protein is coded in complementary strand; from 1961453 to 1959690)