Sequence retrieval

Genome: Mycobacterium abscessus subsp. bolletii 50594
Start position: 2207729
End position: 2207752
Length: 24

DNA sequence
>NC_021282, from 2207729 to 2207752 (24 bp); Mycobacterium abscessus subsp. bolletii 50594 GGCAGCAGCAGCGGCGGCGGCAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2207358-2208929	Sequence	MASS_2160 - hypothetical protein (Protein is coded in complementary strand; from 2208929 to 2207358)