Sequence retrieval

Genome: Mycobacterium abscessus subsp. bolletii 50594
Start position: 2480981
End position: 2481007
Length: 27

DNA sequence
>NC_021282, from 2480981 to 2481007 (27 bp); Mycobacterium abscessus subsp. bolletii 50594 GTAGTCCTGGTAGTCCTCGTACTCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2480742-2482181	Sequence	MASS_2419 - proline rich protein (Protein is coded in complementary strand; from 2482181 to 2480742)