Sequence retrieval

Genome: Mycobacterium abscessus subsp. bolletii 50594
Start position: 2640633
End position: 2640656
Length: 24

DNA sequence
>NC_021282, from 2640633 to 2640656 (24 bp); Mycobacterium abscessus subsp. bolletii 50594 CCTGCGCCAGCGCCTCCGGCTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2639630-2641039	Sequence	MASS_2593 - hypothetical protein (Protein is coded in complementary strand; from 2641039 to 2639630)