Sequence retrieval

Genome: Mycobacterium abscessus subsp. bolletii 50594
Start position: 2767642
End position: 2767668
Length: 27

DNA sequence
>NC_021282, from 2767642 to 2767668 (27 bp); Mycobacterium abscessus subsp. bolletii 50594 CGACCAGGCCGACCAGGTCGACGAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2767629-2768651	Sequence	MASS_2719 - glyceraldehyde-3-phosphate dehydrogenase, type I (Protein is coded in complementary strand; from 2768651 to 2767629)