Sequence retrieval

Genome: Mycobacterium abscessus subsp. bolletii 50594
Start position: 2938572
End position: 2938595
Length: 24

DNA sequence
>NC_021282, from 2938572 to 2938595 (24 bp); Mycobacterium abscessus subsp. bolletii 50594 CAGGGGGCCAGGCGGCCGGGGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2937919-2938788	Sequence	MASS_2882 - putative hydrolase (Protein is coded in complementary strand; from 2938788 to 2937919)