Sequence retrieval

Genome: Mycobacterium abscessus subsp. bolletii 50594
Start position: 3002699
End position: 3002743
Length: 45

DNA sequence
>NC_021282, from 3002699 to 3002743 (45 bp); Mycobacterium abscessus subsp. bolletii 50594 AAGGCGCCTGCCAAGAAGGCACCGGCCAAGAAGGCACCCGCGAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3002589-3003992	Sequence	MASS_2945 - RNA polymerase sigma factor