Sequence retrieval

Genome: Mycobacterium abscessus subsp. bolletii 50594
Start position: 3066294
End position: 3066332
Length: 39

DNA sequence
>NC_021282, from 3066294 to 3066332 (39 bp); Mycobacterium abscessus subsp. bolletii 50594 GTTGTATCCCTCGGTTGTATCCCTGGGTTCTATCCCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3066324-3067085	Sequence	MASS_3025 - FAD-dependent thymidylate synthase (Protein is coded in complementary strand; from 3067085 to 3066324)