Sequence retrieval

Genome: Mycobacterium abscessus subsp. bolletii 50594
Start position: 3213188
End position: 3213211
Length: 24

DNA sequence
>NC_021282, from 3213188 to 3213211 (24 bp); Mycobacterium abscessus subsp. bolletii 50594 GGTTCGGGCTCGGGTTCAGGTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3212234-3213595	Sequence	MASS_3184 - signal recognition particle-docking protein FtsY (Protein is coded in complementary strand; from 3213595 to 3212234)