Sequence retrieval

Genome: Mycobacterium abscessus subsp. bolletii 50594
Start position: 3267383
End position: 3267427
Length: 45

DNA sequence
>NC_021282, from 3267383 to 3267427 (45 bp); Mycobacterium abscessus subsp. bolletii 50594 CGGCCCTTCTTGGCCGGAGCCTTCTTGGCCGGGGCCTTCTTGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3267377-3268000	Sequence	MASS_3237 - hypothetical protein (Protein is coded in complementary strand; from 3268000 to 3267377)