Sequence retrieval

Genome: Mycobacterium abscessus subsp. bolletii 50594
Start position: 3294624
End position: 3294653
Length: 30

DNA sequence
>NC_021282, from 3294624 to 3294653 (30 bp); Mycobacterium abscessus subsp. bolletii 50594 AGGGCGCGCGATGGCGCGCCATGGCGTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3294146-3295111	Sequence	MASS_3256 - putative regulatory protein