Sequence retrieval

Genome: Mycobacterium abscessus subsp. bolletii 50594
Start position: 3368805
End position: 3368867
Length: 63

DNA sequence
>NC_021282, from 3368805 to 3368867 (63 bp); Mycobacterium abscessus subsp. bolletii 50594 CCGCGCCGCGAGCACCGCACGCCGCACCGCGAGTACCGCACGCCGCACCGCGAGTACCGCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3368752-3368889	Sequence	MASS_3328 - hypothetical protein (Protein is coded in complementary strand; from 3368889 to 3368752)