Sequence retrieval

Genome: Mycobacterium abscessus subsp. bolletii 50594
Start position: 3375507
End position: 3375536
Length: 30

DNA sequence
>NC_021282, from 3375507 to 3375536 (30 bp); Mycobacterium abscessus subsp. bolletii 50594 GCCGTATGCCGCCGTTCGCCGCCACATGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3375032-3375604	Sequence	MASS_3336 - putative transcriptional regulator, TetR