Sequence retrieval

Genome: Mycobacterium abscessus subsp. bolletii 50594
Start position: 3482335
End position: 3482370
Length: 36

DNA sequence
>NC_021282, from 3482335 to 3482370 (36 bp); Mycobacterium abscessus subsp. bolletii 50594 CCTGCTGTTGGGCCTGCTGTGGCGACTGCTGTTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3481626-3482861	Sequence	MASS_3473 - hypothetical protein (Protein is coded in complementary strand; from 3482861 to 3481626)