Sequence retrieval

Genome: Mycobacterium abscessus subsp. bolletii 50594
Start position: 355814
End position: 355858
Length: 45

DNA sequence
>NC_021282, from 355814 to 355858 (45 bp); Mycobacterium abscessus subsp. bolletii 50594 TCCGGGACCGCCAAATCCAGGCCCACCAAAACCGGGCCCGCCAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 355341-355910	Sequence	MASS_0320 - hypothetical protein (Protein is coded in complementary strand; from 355910 to 355341)