Sequence retrieval

Genome: Mycobacterium abscessus subsp. bolletii 50594
Start position: 3572311
End position: 3572337
Length: 27

DNA sequence
>NC_021282, from 3572311 to 3572337 (27 bp); Mycobacterium abscessus subsp. bolletii 50594 CGGCCGCACCGGCCGCGCCGGCCGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3571269-3572741	Sequence	MASS_3560 - DEAD-box ATP-dependent RNA helicase CshA