Sequence retrieval

Genome: Mycobacterium abscessus subsp. bolletii 50594
Start position: 3687976
End position: 3688011
Length: 36

DNA sequence
>NC_021282, from 3687976 to 3688011 (36 bp); Mycobacterium abscessus subsp. bolletii 50594 GCAGGTCATGCAACAGGTCATGCAGCAGGGCCTGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3687792-3689144	Sequence	MASS_3677 - cell wall-associated hydrolase, invasion-associated protein