Sequence retrieval

Genome: Mycobacterium abscessus subsp. bolletii 50594
Start position: 4069911
End position: 4069940
Length: 30

DNA sequence
>NC_021282, from 4069911 to 4069940 (30 bp); Mycobacterium abscessus subsp. bolletii 50594 CGGGCACCCGGGGGCGCCCGATGGCACCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4068932-4070170	Sequence	MASS_4070 - transcriptional regulator/sugar kinase (Protein is coded in complementary strand; from 4070170 to 4068932)