Sequence retrieval

Genome: Mycobacterium abscessus subsp. bolletii 50594
Start position: 4422395
End position: 4422421
Length: 27

DNA sequence
>NC_021282, from 4422395 to 4422421 (27 bp); Mycobacterium abscessus subsp. bolletii 50594 GGCCGGGTTGTCCGGGTTGTCCGGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4421295-4422965	Sequence	MASS_4406 - putative fatty-acid-CoA ligase FadD (Protein is coded in complementary strand; from 4422965 to 4421295)