Sequence retrieval

Genome: Mycobacterium abscessus subsp. bolletii 50594
Start position: 4777416
End position: 4777439
Length: 24

DNA sequence
>NC_021282, from 4777416 to 4777439 (24 bp); Mycobacterium abscessus subsp. bolletii 50594 CACCGCCACGGCCACCGCCACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4775605-4778436	Sequence	MASS_4735 - membrane protein MmpL (Protein is coded in complementary strand; from 4778436 to 4775605)