Sequence retrieval

Genome: Bacillus licheniformis 9945A
Start position: 2655479
End position: 2655502
Length: 24

DNA sequence
>NC_021362, from 2655479 to 2655502 (24 bp); Bacillus licheniformis 9945A CATCGCCAGCGCCCTCGCAATCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2655216-2655944	Sequence	BaLi_c26590 artR high affinity arginine ABC transporter ATP-binding protein ArtR (Protein is coded in complementary strand; from 2655944 to 2655216)