Sequence retrieval

Genome: Bacillus licheniformis 9945A
Start position: 3077093
End position: 3077116
Length: 24

DNA sequence
>NC_021362, from 3077093 to 3077116 (24 bp); Bacillus licheniformis 9945A CAGCGACAGCCAAAGCGACCGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3075865-3077580	Sequence	BaLi_c30880 polX DNA polymerase X (Protein is coded in complementary strand; from 3077580 to 3075865)