Sequence retrieval

Genome: Bacillus licheniformis 9945A
Start position: 3228052
End position: 3228075
Length: 24

DNA sequence
>NC_021362, from 3228052 to 3228075 (24 bp); Bacillus licheniformis 9945A CCGCTTTCGCTTTCGCTTCCACTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3226962-3228086	Sequence	BaLi_c32320 rapA2 response regulator aspartate phosphatase RapA (Protein is coded in complementary strand; from 3228086 to 3226962)