Sequence retrieval

Genome: Bacillus licheniformis 9945A
Start position: 2780742
End position: 2780766
Length: 25

DNA sequence
>NC_021362, from 2780742 to 2780766 (25 bp); Bacillus licheniformis 9945A CCCAGCCAAGCCCGGCGCAGCCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2780237-2781124	Sequence	BaLi_c27990 glyQ glycyl-tRNA ligase alpha subunit GlyQ (Protein is coded in complementary strand; from 2781124 to 2780237)