Sequence retrieval

Genome: Bacillus licheniformis 9945A
Start position: 1198438
End position: 1198464
Length: 27

DNA sequence
>NC_021362, from 1198438 to 1198464 (27 bp); Bacillus licheniformis 9945A TAATAGTAGTAATAATAGTAGTAGTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1198345-1198542	Sequence	BaLi_c12200 ynzH spore coat protein YnzH (Protein is coded in complementary strand; from 1198542 to 1198345)