Sequence retrieval

Genome: Bacillus licheniformis 9945A
Start position: 4341246
End position: 4341275
Length: 30

DNA sequence
>NC_021362, from 4341246 to 4341275 (30 bp); Bacillus licheniformis 9945A TATATTTTTTTATTTTTTTCTATTATTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 4341269-4341682	Sequence	BaLi_c43220 - putative phosphohydrolase (Protein is coded in complementary strand; from 4341682 to 4341269)