Sequence retrieval

Genome: Bacillus licheniformis 9945A
Start position: 1643083
End position: 1643118
Length: 36

DNA sequence
>NC_021362, from 1643083 to 1643118 (36 bp); Bacillus licheniformis 9945A CGGGATCATCGGCGGGATCATCGGCGGGATCATCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1642845-1643540	Sequence	BaLi_c16830 yknW antimicrobial peptide ABC exporter permease YknW