Sequence retrieval

Genome: Bacillus licheniformis 9945A
Start position: 2339185
End position: 2339220
Length: 36

DNA sequence
>NC_021362, from 2339185 to 2339220 (36 bp); Bacillus licheniformis 9945A CGGGAATCTGGCCGGGAATCTGGCCGGGTATCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2338967-2339257	Sequence	BaLi_c23560 yojB YojB (Protein is coded in complementary strand; from 2339257 to 2338967)