Sequence retrieval

Genome: Bacillus licheniformis 9945A
Start position: 743566
End position: 743601
Length: 36

DNA sequence
>NC_021362, from 743566 to 743601 (36 bp); Bacillus licheniformis 9945A GTTTTATCCGTTTTATCCGTTTTATCCGTTTTATCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 743452-743709	Sequence	BaLi_c07630 - hypothetical protein (Protein is coded in complementary strand; from 743709 to 743452)