Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 1180131
End position: 1180154
Length: 24

DNA sequence
>NC_021577, from 1180131 to 1180154 (24 bp); Pseudomonas aeruginosa RP73 CCATGGCCATGGCCATGGCCATGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1180005-1180223	Sequence	M062_05640 - zinc chelation protein SecC (Protein is coded in complementary strand; from 1180223 to 1180005)