Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 1481389
End position: 1481412
Length: 24

DNA sequence
>NC_021577, from 1481389 to 1481412 (24 bp); Pseudomonas aeruginosa RP73 TGGTCGTGGTGGTGGTGGTGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1480939-1481901	Sequence	M062_07055 - cation transporter (Protein is coded in complementary strand; from 1481901 to 1480939)