Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 1524444
End position: 1524467
Length: 24

DNA sequence
>NC_021577, from 1524444 to 1524467 (24 bp); Pseudomonas aeruginosa RP73 CGGCGCTGGCGCCGGCGCCGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1523516-1524604	Sequence	M062_07255 - glutaminase (Protein is coded in complementary strand; from 1524604 to 1523516)