Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 1955237
End position: 1955260
Length: 24

DNA sequence
>NC_021577, from 1955237 to 1955260 (24 bp); Pseudomonas aeruginosa RP73 GGAGCCGCAGCCGGTGCCGCAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1955178-1957904	Sequence	M062_09275 - nitrate reductase subunit alpha (Protein is coded in complementary strand; from 1957904 to 1955178)