Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 200569
End position: 200592
Length: 24

DNA sequence
>NC_021577, from 200569 to 200592 (24 bp); Pseudomonas aeruginosa RP73 GGCCTCGGCCGCGGCCGCGGCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 200381-202420	Sequence	M062_00885 - chemotaxis protein (Protein is coded in complementary strand; from 202420 to 200381)