Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 2287537
End position: 2287560
Length: 24

DNA sequence
>NC_021577, from 2287537 to 2287560 (24 bp); Pseudomonas aeruginosa RP73 CCTCGTCGTCGTCCTCGCCCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2287503-2288558	Sequence	M062_10740 - copper resistance protein B (Protein is coded in complementary strand; from 2288558 to 2287503)