Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 2303833
End position: 2303856
Length: 24

DNA sequence
>NC_021577, from 2303833 to 2303856 (24 bp); Pseudomonas aeruginosa RP73 TCGGCCTCGCCCTCGGCGCCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2303149-2304816	Sequence	M062_10785 - hypothetical protein (Protein is coded in complementary strand; from 2304816 to 2303149)