Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 2330962
End position: 2330985
Length: 24

DNA sequence
>NC_021577, from 2330962 to 2330985 (24 bp); Pseudomonas aeruginosa RP73 GGCCGAGGCCGCGGTCGATGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2330013-2331047	Sequence	M062_10895 - AraC family transcriptional regulator (Protein is coded in complementary strand; from 2331047 to 2330013)