Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 2618287
End position: 2618310
Length: 24

DNA sequence
>NC_021577, from 2618287 to 2618310 (24 bp); Pseudomonas aeruginosa RP73 CGTCGGCGCCGGCGGCGGCGTTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2617227-2618843	Sequence	M062_12170 - phosphonate monoester hydrolase (Protein is coded in complementary strand; from 2618843 to 2617227)