Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 2880010
End position: 2880033
Length: 24

DNA sequence
>NC_021577, from 2880010 to 2880033 (24 bp); Pseudomonas aeruginosa RP73 CCAGCGCCACCGCCAGCGCCAGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2877912-2881043	Sequence	M062_13140 - multidrug transporter (Protein is coded in complementary strand; from 2881043 to 2877912)