Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 2970077
End position: 2970100
Length: 24

DNA sequence
>NC_021577, from 2970077 to 2970100 (24 bp); Pseudomonas aeruginosa RP73 CGAGGACGAGCAGGAGGACGACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2969968-2970117	Sequence	M062_13570 - hypothetical protein
ORF... 2970101-2970322	Sequence	M062_13575 - hypothetical protein