Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 3564183
End position: 3564206
Length: 24

DNA sequence
>NC_021577, from 3564183 to 3564206 (24 bp); Pseudomonas aeruginosa RP73 CACCACCGCCACCACCAGCAGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3563242-3564243	Sequence	M062_16560 - general secretion pathway protein K (Protein is coded in complementary strand; from 3564243 to 3563242)