Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 3805812
End position: 3805835
Length: 24

DNA sequence
>NC_021577, from 3805812 to 3805835 (24 bp); Pseudomonas aeruginosa RP73 CCGGCAGCGGCACCCGCACCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3805541-3805996	Sequence	M062_17740 - membrane protein (Protein is coded in complementary strand; from 3805996 to 3805541)