Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 4230197
End position: 4230220
Length: 24

DNA sequence
>NC_021577, from 4230197 to 4230220 (24 bp); Pseudomonas aeruginosa RP73 GGCGCGGCTGCGCGGCGGCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4229766-4230458	Sequence	M062_19705 - nuclease (Protein is coded in complementary strand; from 4230458 to 4229766)