Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 4428572
End position: 4428595
Length: 24

DNA sequence
>NC_021577, from 4428572 to 4428595 (24 bp); Pseudomonas aeruginosa RP73 CGGCGCCGGCCCCGACGCCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4428508-4429998	Sequence	M062_20605 - RND transporter (Protein is coded in complementary strand; from 4429998 to 4428508)