Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 4451250
End position: 4451273
Length: 24

DNA sequence
>NC_021577, from 4451250 to 4451273 (24 bp); Pseudomonas aeruginosa RP73 CGGCAGCGCCAGCGGCCGCGGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4451038-4452270	Sequence	M062_20705 - molybdenum cofactor biosynthesis protein MoaA (Protein is coded in complementary strand; from 4452270 to 4451038)