Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 4574851
End position: 4574874
Length: 24

DNA sequence
>NC_021577, from 4574851 to 4574874 (24 bp); Pseudomonas aeruginosa RP73 CCAGGAGCAGGACCAGGGCCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4574031-4574924	Sequence	M062_21255 - protein kinase
ORF. 4574817-4576400	Sequence	M062_21260 - protein kinase (Protein is coded in complementary strand; from 4576400 to 4574817)