Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 4601679
End position: 4601702
Length: 24

DNA sequence
>NC_021577, from 4601679 to 4601702 (24 bp); Pseudomonas aeruginosa RP73 TCGCCGACGCCGTCGACGTGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4601343-4602002	Sequence	M062_21395 - riboflavin synthase subunit alpha (Protein is coded in complementary strand; from 4602002 to 4601343)