Sequence retrieval

Genome: Pseudomonas aeruginosa RP73
Start position: 4756675
End position: 4756698
Length: 24

DNA sequence
>NC_021577, from 4756675 to 4756698 (24 bp); Pseudomonas aeruginosa RP73 GGCCAGGACCAGGGTCAGGGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4756073-4756777	Sequence	M062_22095 - ABC transporter permease (Protein is coded in complementary strand; from 4756777 to 4756073)